 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_0002124 | |||
| Gene | NuSAP1 | Organism | Human |
| Genome Locus | chr15:41667909-41669502:n/a | Build | hg19 |
| Disease | Hepatocellular Carcinoma | ICD-10 | Liver cell carcinoma (C22.0) |
| DBLink | Link to database | PMID | http://tcr.amegroups.com/article/view/27058 |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | HCC tissues and their paired pericarcinomatous tissues of 20 patients with HCC |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward AAACAACCCCATCTCCAGACA ReverseAGGGGACGAGACAAA CTTGC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| http://tcr.amegroups.com/article/view/27058 | |||